FIMA
Data Integration Module
In EMBL:      " Crepis albida "
                                        Results:
1 - 2 - 3
EMBL entry: Y16285
Title: >ENA|Y16285|Y16285.2 Crepis alpina mRNA for delta 12 fatty acid acetylenase
Sequence (FASTA):>ENA|Y16285|Y16285.2 Crepis alpina mRNA for delta 12 fatty acid acetylenase
TTTCACTATTAATCATTTATCAACAAGATGGGTGGCGGTGGCCGTGGTCGGACTTCGCAAAAACCCCTCATGGAACGTGTCTCAGTTGATCCACCCTTCA
CCGTGAGTGATCTCAAGCAAGCAATCCCTCCCCATTGCTTCAAGCGATCTGTAATCCGTTCCTCTTACTACATAGTCCACGATGCTATTATCGCCTACAT
CTTCTACTTCCTTGCCGACAAATACATTCCGATTCTCCCTGCCCCTCTAGCCTACCTCGCTTGGCCCCTTTACTGGTTCTGTCAAGCTAGCATCCTCACC
GGCTTATGGGTCATCGGTCACGAATGCGGTCACCATGCCTTCAGCGACTACCAGTGGGTTGACGACACTGTGGGCTTCATCCTCCACTCGTTTCTCATGA
CCCCGTATTTCTCCTGGAAATACAGCCACCGGAACCACCATGCCAACACAAATTCGCTTGACAACGATGAAGTTTACATCCCCAAAAGCAAGGCCAAAGT
CGCGCTTTACTATAAAGTTCTCAACCACCCACCTGGCCGA
... see the full sequence.
See the full EMBL entry: Y16285
Related UniProt entry: O81931
FIMA Data Integration Module is based on an expanded and improved version of the algorithm reported in the following reference.
Primary citation: Abdelkrim Rachedi et al., GABAagent: a system for integrating data on GABA receptors. Bioinformatics. 2000 Apr;16(4):301-12.