Genomic data-entry: EPI_ISL_418241

Description: Severe acute respiratory syndrome coronavirus 2 SARS-CoV-2, betacoronavirus,
hCoV-19/Algeria/G0638_2264/2020 - GISAID, NIC Viral Respiratory Unit - Institut Pasteur of Algeria

  - Genome source: Boufarik, Algeria

  - Mutations: 11 mutations; including the genes coding for the Main Protease (Mpro), the RdRp polymerase and in the
    Spike protein (highlted in the section below Genome Structure & Organization). These mutations are Potential Drug
    Design Reseach Targets
towards finding cures and vaccines against COVID-19 disease.


Sequence (FASTA):>Severe acute respiratory syndrome coronavirus 2 SARS-CoV-2, betacorona ...
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTAGATCTGTTCTCTAAACGAACTTTAA
AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG
ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
TGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC
CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT
CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA
ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG
AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA
... follow the GISAID link below to access the full sequence.

Related protein structures:                              

Genome Structure & Organization:

Evolutionary Relationships:


See the full Genomic-data entry:
GISAID EPI ISL: 418241     ( Note: GISAID requires registration to access full data. )
The Viruses system, created by the DIRC Data Integration Module, is based on an improved version of the algorithm reported in the following reference:
Abdelkrim Rachedi et al., GABAagent: a system for integrating data on GABA receptors. Bioinformatics. 2000 Apr;16(4):301-12.

Viruses β-v.4.0 - July. 2021, © Abdelkrim Rachedi at the Dept. of Biology, Saida University, Algeria, 2020.
E-mail: rachedi@bioinformaticstools.org

Disclaimer: The Viruses Database system offers data as they are from sources(*) used in the data integration. The data are by no mean complete about all types viruses, however, the database is regularly updatad and
the tool system is continuously further developed. (*)Primarily the COVID-19 Genomics UK Consortium (COG-UK), NCBI/Genbank, EMBL genomics data & PDB structural data.